Alternative yeast nuclear code
In today's world, Alternative yeast nuclear code is an issue that has taken on great relevance in society. For a long time, Alternative yeast nuclear code has been the subject of debate and discussion, since its impact covers different aspects of daily life. Whether in the personal, work, cultural or social sphere, Alternative yeast nuclear code has become a topic that leaves no one indifferent. Its importance lies in its influence on our decisions, the way we perceive the world around us and how we relate to others. In this article, we will thoroughly explore the concept of Alternative yeast nuclear code and its impact on our daily lives, in order to better understand its meaning and be able to analyze its relevance today.
The alternative yeast nuclear code (translation table 12) is a genetic code found in certain yeasts. However, other yeast, including Saccharomyces cerevisiae, Candida azyma, Candida diversa, Candida magnoliae, Candida rugopelliculosa, Yarrowia lipolytica, and Zygoascus hellenicus, definitely use the standard (nuclear) code.[1]
The code
AAs = FFLLSSSSYY**CC*WLLLSPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -------------------M---------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Differences from the standard code
| DNA codons | RNA codons | This code (12) | Standard code (1) | |
|---|---|---|---|---|
CTG |
CUG |
Ser (S) |
Leu (L)
|
Alternative initiation codons
- CAG may be used in Candida albicans.[2]
Systematic range
- Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa.[1]
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ a b T. Ohama; T. Suzuki; M. Mori; S. Osawa; T. Ueda; K. Watanabe; T. Nakase (25 August 1993). "Non-universal decoding of the leucine codon CUG in several Candida species". Nucleic Acids Res. 21 (17): 4039–45. doi:10.1093/nar/21.17.4039. PMC 309997. PMID 8371978.
- ^ M. A. Santos; G. Keith; M. F. Tuite (February 1993). "Non-standard translational events in Candida albicans mediated by an unusual seryl-tRNA with a 5'-CAG-3' (leucine) anticodon". EMBO J. 12 (2): 607–16. doi:10.1002/j.1460-2075.1993.tb05693.x. PMC 413244. PMID 8440250.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 19 March 2016.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |