Pachysolen tannophilus nuclear code
Nowadays, Pachysolen tannophilus nuclear code has become a topic of great relevance in today's society. From its impact on everyday life to its influence on the global economy, Pachysolen tannophilus nuclear code has gained a prominent place in current conversations and debates. As we delve deeper into the world of Pachysolen tannophilus nuclear code, it is crucial to understand its importance and the implications it carries. In this article, we will explore in depth the different facets of Pachysolen tannophilus nuclear code and how its presence continues to shape our ever-evolving world.
The pachysolen tannophilus nuclear code (translation table 26) is a genetic code found in the ascomycete fungus Pachysolen tannophilus.[1]
Code
AAs = FFLLSSSSYY**CC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -------------------M---------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (26) | Standard code (1) | |
|---|---|---|---|---|
CTG |
CUG |
Ala (A) |
Leu (L)
|
Initiation codons
This code uses the initiation codons AUG, GUG and UUG.
Systematic range and comments
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [2]
- ^ Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin (2016). "A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes". Genome Research. 26 (7): 945–955. doi:10.1101/gr.200931.115. ISSN 1088-9051. PMC 4937558. PMID 27197221.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 11 August 2016.