Trematode mitochondrial code
In this article, we will explore Trematode mitochondrial code from a completely new perspective, analyzing all the aspects surrounding it to provide a complete and detailed overview of this topic. From its origin to its influence today, we will comprehensively examine each facet of Trematode mitochondrial code, to help understand its importance and relevance in different contexts. Through extensive research and a multidisciplinary approach, we will seek to shed light on Trematode mitochondrial code and unravel the mysteries surrounding it. Synthesizing different sources and points of view, we will seek to offer a rigorous and objective analysis of Trematode mitochondrial code, allowing the reader to delve in depth into this exciting topic.
The trematode mitochondrial code (translation table 21) is a genetic code found in the mitochondria of Trematoda.
Code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNNKSSSSVVVVAAAADDEEGGGGStarts = -----------------------------------M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (21) | Standard code (1) | |
|---|---|---|---|---|
| TGA | UGA | Trp (W) | STOP = Ter (*) | |
| ATA | AUA | Met (M) | Ile (I) | |
| AGA | AGA | Ser (S) | Arg (R) | |
| AGG | AGG | Ser (S) | Arg (R) | |
| AAA | AAA | Asn (N) | Lys (K) |
Systematic range and comments
See also
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain. [3]
- ^ Evolution of the mitochondrial genetic code. IV. AAA as an asparagine codon in some animal mitochondria. Ohama, T, S. Osawa, K. Watanabe, T.H. Jukes, 1990. J. Molec Evol. 30
- ^ Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNA(serAGN) that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons Garey, J.R. and D.R. Wolstenholme, 1989. J. Molec. Evol. 28: 374-387 329-332.
- ^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), US National Library of Medicine. Retrieved 11 August 2016.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |